Search Results for ''

published presentations and documents on DocSlides.

Types of Characters in Fiction

Types of Characters in Fiction

by luanne-stotts

Round. A round character has a complex personalit...

Principals and Pillars The Characters in

Principals and Pillars The Characters in

by lucinda

Craft and Capitular Masonry. Nicholas J. . Sampogn...

by faustina-dinatale

A literary device. Purpose. shows the audience or...

by tatiana-dople

American Realism. American Realism in context of ...

Understanding and Evaluating..

Understanding and Evaluating..

by olivia-moreira

Drama. Question One: . Does the play employ reali...

Individuality & Conformity Unit Vocabulary Definitions

Individuality & Conformity Unit Vocabulary Definitions

by liane-varnes

The vocabulary terms from this class will be roug...

METAPHORS and STYLES in FICTION

METAPHORS and STYLES in FICTION

by danika-pritchard

METAPHOR (Figure of Speech). Is a mode of express...

Festivals of Russia

Festivals of Russia

by jane-oiler

Saarh. H. . Alkhatem. 201200563. . Outlines: . ...

Part D : irony A contrast between appearance and reality – usually one in which reality is the

Part D : irony A contrast between appearance and reality – usually one in which reality is the

by tawny-fly

Irony in characters:. Unfunny clownfish. …. C...

Harry Potter & The Deathly Hallows

Harry Potter & The Deathly Hallows

by lois-ondreau

Book by: J.K. Rowling. Presentation by: Student 1...

Visual Literacy Terminology

Visual Literacy Terminology

by aaron

Participant. Who and what is represented. Gaze. D...

Mrs. Stamper & Mrs. Bryant’s Pre K Class

Mrs. Stamper & Mrs. Bryant’s Pre K Class

by myesha-ticknor

. GOOD, BETTER, BEST!. Theme and Activities. Our...

What is theme and how do you find it?

What is theme and how do you find it?

by phoebe-click

What is theme? . Theme . is the author’s argume...

The choice of typeface is less important than contrast, type size, wei

The choice of typeface is less important than contrast, type size, wei

by pasty-toler

typeface the spacing of characters. Quirky, unusua...

Attacking the Prompt

Attacking the Prompt

by yoshiko-marsland

Building an Essay. The Strategy in a Nut-Shell. C...

Realism in Classical American Film

Realism in Classical American Film

by sherrill-nordquist

Hollywood Narrative. Table of Contents. 1 Realist...

Introductions and Conclusions

Introductions and Conclusions

by ellena-manuel

Content adapted from . http://writingcenter.unc....

by tatiana-dople

Hira. . Waseem. Lexical Analysis . Input Bufferi...

ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA

ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA

by celsa-spraggs

DNA sequencing. Why? . – Identifies Organisms. ...

by conchita-marotz

Bram Stoker’s. Bram Stoker. Born in Dublin on N...

Studying Short Stories

Studying Short Stories

by celsa-spraggs

Genre Intro. What do we already know about short ...

PACTS in LITERATURE

PACTS in LITERATURE

by jane-oiler

How do we interpret, understand, and make meaning...

F. Scott Fitzgerald

F. Scott Fitzgerald

by tatiana-dople

“And do you write for any other magazines?” i...

Of Mice and Men

Of Mice and Men

by alida-meadow

Culture and Times of the Dust Bowl Era. Essential...

by trish-goza

. When. and . where. a story takes place. As t...

Drama presentation

Drama presentation

by ellena-manuel

Greek shadow puppet theatre: . Karagiozis. Conor ...

by olivia-moreira

Period 1. Manali, Bhrigu, Jessica, Taz, and Margo...

Extract questions

Extract questions

by aaron

You will be given an extract of about a page and ...

Folklore: Myths, Folktales, Legends, and Fables

Folklore: Myths, Folktales, Legends, and Fables

by celsa-spraggs

Folklore. . can be defined. …. . as all the t...

by phoebe-click

academic conversation. What is an academic conver...

View the slides to gain a better understanding of what I ex

View the slides to gain a better understanding of what I ex

by cheryl-pisano

There is a slide dedicated to each role for you t...

CREATING A TIMELINE FOR YOUR NOVEL

CREATING A TIMELINE FOR YOUR NOVEL

by stefany-barnette

www.jillwilliamson.com/teenage-authors/helps. or....

Folklore: Myths, Folktales, Legends, and Fables

Folklore: Myths, Folktales, Legends, and Fables

by alexa-scheidler

Folklore. . can be defined. …. . as all the t...

British Literature The Victorian Era 1837 - 1901

British Literature The Victorian Era 1837 - 1901

by danika-pritchard

Optimism and the Belief in Progress. Britain's po...

The Origins of Drama The highly abridged version!!!!!

The Origins of Drama The highly abridged version!!!!!

by calandra-battersby

Ancient Greek Drama. Drama festivals began in Ath...

Setting When and where

Setting When and where

by celsa-spraggs

a story takes place. As the place of fiction, se...

The Outsiders Mid Book Review

The Outsiders Mid Book Review

by pasty-toler

Chapter One. Characters. Settings. Important Info...

Arthurian Legends An Introduction for Mind-mapping

Arthurian Legends An Introduction for Mind-mapping

by test

Legend: A definition. Imaginative tale believed ...

Arthurian Legends An Introduction for Mind-mapping

Arthurian Legends An Introduction for Mind-mapping

by marina-yarberry

Legend: A definition. Imaginative tale believed ...

by jade

Rock Star & Class Act Discussion and Activity Guid...